Protocols and Methods
yeast cells, graphic

This page presents protocols and useful information that we utilize in our lab to induce GAL::HO endonuclease and analyze the results. Rather than attempt to present a comprehensive list of all the protocols used in our lab, we have focussed on those methods relevant to the study of DNA double strand breaks (DSBs) while attempting to provide a few insights into some of these methods. Readers will also be able to find information in various methods papers published by our lab. Other protocols that we use in our laboratory can be found in commonly used molecular biology lab manuals and on the web. In yeast labs, the Cold Spring Harbor Yeast Lab Manual is a commonly used reference, where many methods and recipes are described.

Strain constructions. The GAL::HO construction (Jensen et al 1984) can be integrated into the chromosome or transformed into yeast on centromere-bearing plasmids. For integrations, Sandell and Zakian (1993) constructed a plasmid that can be integrated by homologous recombination at the ade3 locus using URA3 as a selectable marker and then excised using 5-fluoro-orotic acid as a counter-selection medium, leaving a stable ade3::GAL::HO gene. It appears that the plasmid may possess an autonomous replication sequence and hence care should be taken to select for stable integrants. This plasmid also has been modified so that it can be incorporated by one-step transplacement using the NAT gene (Wach et al. 1994) as a selectable marker (pEAI201) (T. Goldfarb) available from E. Alani's lab. While an integrated GAL::HO is more stable, it is sometimes more expedient to use a centromeric plasmid containing GAL:HO. These are available on plasmids with selectable markers such as URA3 (pGAL-HO) (Herskowitz and Jensen, 1991), LEU2 (pJH727), and TRP1 (pFH800) (Nickoloff et al., 1989).

For the recognition sequence, it is convenient to use either the MAT locus or a 117 bp restriction fragment derived from MATa (BglII to HincII restriction fragment). With this sequence we generally achieve greater than 90% cleavage within 30 to 60 min of galactose addition. A 36-bp cleavage site, AGTTTCAGCTTTCCGCAACAGTATAATTTTATAAA, has also given good results in a colony-plating assay (Paques and Haber, 1997).

A complication sometimes stems from the presence of a naturally occurring mutation in the MAT sequence that greatly reduces but does not completely eliminate cutting by the HO endonuclease. This has been designated mat-stk (stuck) (see Ray et al. (1991)) and results from a single nucleotide change in the MATZ sequence (T to A change at position Z11). In the sequence above the bold face T is an A in the mat-stk sequence (AACAGTAT where AACA is where HO endonuclease makes staggered cuts). The unfortunate aspect of this is that the mat-stk sequence is sometimes used as a wild type sequence, a complication that can arise when using substrates constructed synthetically from oligonucleotides.

When constructing strains, it is highly advisable to avoid respiratory deficient (petite) strains (Evans and Wilkie, 1976; Mahler and Wilkie, 1978) and gal3 mutants (Douglas and Pelroy, 1963). Petite strains can be identified by their failure to grow on glycerol, lactate, acetate or ethanol media. Because the presence or absence of the GAL3 gene is often undocumented, it is sometimes necessary to test for this mutation. It turns out that gal3 mutants can grow on galactose medium but not if the oxidative pathway is blocked. To do this we test for gal3 mutants on galactose medium under anaerobic conditions using the set-up described in the accompanying PDF .(2/14/02).

Galactose Inductions. Most of our current work relies heavily on galactose induction of the HO endonuclease. This PDF document describes the induction of GAL::HO in yeast cells in liquid cultures. Cells can be harvested at different time points after induction and analyzed by various methods. PDF (7/18/05)

Glass Bead DNA MiniPreps. After HO endonuclease has been induced, we extract the DNA from the cells by vortexing them with glass beads in a phenol-SDS solution. This protocol was chosen because it kills the cells and stops the reaction in a relatively quick manner. PDF.(2/14/02)

Denaturing Gels. When we specifically wish to look at the formation of single stranded DNA after a double strand break is made, we electrophorese DNA on alkaline denaturing gels. Single stranded DNA cannot be cut by most but not all restriction enzymes and hence runs as longer DNA segments on denaturing gels where they migrate at positions similar to partial digestion products. When run on native, neutral gels, the single stranded intermediate does not appear as a discrete band presumeably because it is heterogeneous in mass due to the loss of DNA of varying lengths (White and Haber 1990). An alternative way to examine single strand DNA formation is to utilize slot blots (see below). PDF.(2/14/02)

Slot or Dot Blots. Slot blots can be utilized to quantitate the presence of single stranded DNA by binding native, non-denatured DNA to membranes. When used with single stranded probes they can also be used to assay the degradation of specific strands of DNA by binding denatured DNA to the membranes. With denaturing and native gels some of the single stranded DNA will run as smears, whereas with slot blots this DNA is concentrated into a single spot where it can be reliably quantititated (Sugawara and Haber 1993). PDF.(2/14/02)

Chromatin Immunoprecipitation. When a double strand break is made, a large number of proteins associate with the break. These include proteins involved with chromatin remodeling, cell cycle arrest, non-homologous end joining, recombination, mismatch repair, and cohesins. These interactions have been identified and explored by using such techniques as chromatin immunoprecipitation (ChIP), immunofluorescent staining, and fluorescent tagging of proteins. The ChIP technique (figure) involves using in vivo crosslinking to bind chromatin-associated proteins to DNA and then to isolate these complexes by immunoprecipitating them with specific antibodies. Crosslinks (made with formaldehyde) can be removed and the DNA can be analyzed by PCR or other means to determine whether specific DNA sequences are associated with the protein of interest. PDF (7/18/05).

Zymolyase DNA MiniPreps. This procedure was derived from a protocol given in the Cold Spring Harbor Yeast Manual. Over the years, various steps were omitted and some concentrations were altered resulting a more streamlined version of this protocol. PDF.(2/14/02)

Recipes. It is important to note that galactose should not be autoclaved since it will isomerize at elevated temperatures. Instead, we prepare a fresh 20% stock solution at room temperature (it can take an hour or longer to dissolve) and then filter sterilize it. For plates, we add filter-sterilized galactose after autoclaving. The document Recipes.pdf contains detailed recipes for YEP-Lactate, YEP-GAL and galactose solutions.(2/14/02)




References

Boeke, J. D., Lacroute, F., and Fink, G. R. (1984). A positive selection for mutants lacking orotidine-5'-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197, 345-346.

Douglas, H. C., and Pelroy, G. (1963). A gene controlling the inducibility of galactose pathway enzymes in Saccharomyces cerevisiae. Biochim. Biophys. Acta 68, 155-156.

Evans, I. H., and Wilkie, D. (1976). Mitochondrial role in the induction of sugar utilization in Saccharomyces cerevisiae. In "Function of Mitochondrial DNA" (C. Saccone and A. M. Kroon, Eds.), pp. 209-217. North-Holland, New York.

Herskowitz, I., and Jensen, R. E. (1991). Putting the HO gene to work: practical uses for mating-type switching. Methods Enzymol 194, 132-46.

Jensen, R. E., and Herskowitz, I. (1984). Directionality and regulation of cassette substitution in yeast. Cold Spring Harb. Symp. Quant. Biol. 49, 97-104.

Mahler, H. R., and Wilkie, D. (1978). Mitochondrial control of sugar utilization in Saccharomyces cerevisiae. Plasmid 1, 125-33.

Nickoloff, J. A., Singer, J. D., Hoekstra, M. F., and Heffron, F. (1989). Double-strand breaks stimulate alternative mechanisms of recombination repair. J. Mol. Biol. 207, 527-541.

Paques, F., and Haber, J. E. (1997). Two pathways for removal of nonhomologous DNA ends during double-strand break repair in Saccharomyces cerevisiae. Mol. Cell. Biol. 17, 6765-71.

Ray B. L., White C. I., Haber J. E. (1991). Heteroduplex formation and mismatch repair of the "stuck" mutation during mating-type switching in Saccharomyces cerevisiae. Mol Cell Biol. 11:5372-80.

Sandell, L. L., and Zakian, V. A. (1993). Loss of a yeast telomere: arrest, recovery, and chromosome loss. Cell 75, 729-739.

Sugawara, N., and Haber, J. E. (1992). Characterization of double-strand break-induced recombination: homology requirements and single-stranded DNA formation. Mol. Cell. Biol. 12, 563-575.

Wach, A., Brachat, A., Pohlmann, R., and Philippsen, P. (1994). New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10, 1793-1808.

White, C. I., and Haber, J. E. (1990). Intermediates of recombination during mating type switching in Saccharomyces cerevisiae. EMBO J. 9, 663-673.